View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14353_low_87 (Length: 226)
Name: NF14353_low_87
Description: NF14353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14353_low_87 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 17 - 210
Target Start/End: Original strand, 25309496 - 25309690
Alignment:
| Q |
17 |
cagacaaatcaaaatattagtagtgatagatattatgagacggaaggactatatctttt-tactgtcccgttatctgttaatgttatagataaaagcggc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||||||||| |||||||| | | |
|
|
| T |
25309496 |
cagacaaatcaaaatattagtagtgatagatattatgagacggcaggactatatcttttttactgtcatgttatctgttaatgttattgataaaagtgcc |
25309595 |
T |
|
| Q |
116 |
atgatagctcgtaatgtgcattcatagaaataagggctggatccctgatcatatgtgttgtgtctgtttccgcagtatggattagtgcacatatc |
210 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25309596 |
atgatagcttgtaatgtgcattcatagaaataagggctggagccctgatcatatgagttgtgtctgtttccacagtatggattagtgcacatatc |
25309690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University