View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14353_low_89 (Length: 217)
Name: NF14353_low_89
Description: NF14353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14353_low_89 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 18 - 169
Target Start/End: Original strand, 14110483 - 14110634
Alignment:
| Q |
18 |
gtatgacctacaacctccatgactcaatgggatatagttgatttaggcgatagaggtagttttcttgcttaatacctgcaatgcaaagaagctagaaaag |
117 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |||||| ||| |
|
|
| T |
14110483 |
gtatgagctacaacctccatgactcaatgggatatagttagtttaggcgatagaggtagttttcttgcttaatacctgcaatgtaaagaggctagataag |
14110582 |
T |
|
| Q |
118 |
gaacttaaatgagtagtaacaacagtaaatttataaaggattttgatattag |
169 |
Q |
| |
|
|||||||||||||||| ||||||||| || |||||||||| ||||||||||| |
|
|
| T |
14110583 |
gaacttaaatgagtagcaacaacagtgaagttataaaggactttgatattag |
14110634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 167 - 196
Target Start/End: Complemental strand, 41710396 - 41710367
Alignment:
| Q |
167 |
tagtttcaaatctgtctccttaactgaagg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41710396 |
tagtttcaaatctgtctccttaactgaagg |
41710367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University