View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14353_low_89 (Length: 217)

Name: NF14353_low_89
Description: NF14353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14353_low_89
NF14353_low_89
[»] chr5 (1 HSPs)
chr5 (18-169)||(14110483-14110634)
[»] chr2 (1 HSPs)
chr2 (167-196)||(41710367-41710396)


Alignment Details
Target: chr5 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 18 - 169
Target Start/End: Original strand, 14110483 - 14110634
Alignment:
18 gtatgacctacaacctccatgactcaatgggatatagttgatttaggcgatagaggtagttttcttgcttaatacctgcaatgcaaagaagctagaaaag 117  Q
    |||||| ||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |||    
14110483 gtatgagctacaacctccatgactcaatgggatatagttagtttaggcgatagaggtagttttcttgcttaatacctgcaatgtaaagaggctagataag 14110582  T
118 gaacttaaatgagtagtaacaacagtaaatttataaaggattttgatattag 169  Q
    |||||||||||||||| ||||||||| || |||||||||| |||||||||||    
14110583 gaacttaaatgagtagcaacaacagtgaagttataaaggactttgatattag 14110634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 167 - 196
Target Start/End: Complemental strand, 41710396 - 41710367
Alignment:
167 tagtttcaaatctgtctccttaactgaagg 196  Q
    ||||||||||||||||||||||||||||||    
41710396 tagtttcaaatctgtctccttaactgaagg 41710367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University