View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14354_low_4 (Length: 246)
Name: NF14354_low_4
Description: NF14354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14354_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 8 - 190
Target Start/End: Original strand, 10048937 - 10049119
Alignment:
| Q |
8 |
atgaaggaacatgaacatagttttagttaaggtggcttattttgggaccaatctgattttgtcacaccgaggatacggttgggttcgggtctaaataatt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| ||||||||| |
|
|
| T |
10048937 |
atgaaggaacatgaacatagttttagttaaggtggcttattttgggaccaatctgattttgtcacaccgagtgtatggttgggttcgggtttaaataatt |
10049036 |
T |
 |
| Q |
108 |
ggtccgacttaagttagggtcaaattttgagttctggtctaacctaattcttccttagtttgtctctacatttgtgtgcagtt |
190 |
Q |
| |
|
|||||||| ||||||||| ||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10049037 |
ggtccgacctaagttaggatcaggttttgagttctggtctaacctaattcttccctagtttgtctctacatttgtgtgcagtt |
10049119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University