View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14355_low_13 (Length: 230)
Name: NF14355_low_13
Description: NF14355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14355_low_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 33218635 - 33218853
Alignment:
| Q |
1 |
ttaaaaaatttcaaataggttttggaccggctgaataattgaacctaaa-----taattaagtatgattgtctgaaaaatgcaacaatagaaagnnnnnn |
95 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33218635 |
ttaaaaaatttcaaatagtttttggaccgactgaataattgaacctaaaataattaattaattatgattgtctgaaaaatgcaacaatagaaagaacaaa |
33218734 |
T |
|
| Q |
96 |
nttgtgagtatttaaccataataaagtgttcttattgttgttgttttaggatgttcatcgactcttgcaagaggttaagaataatgaaaagttctgaagc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33218735 |
attgtgagtatttaaccataataaagtgttcttattgttgttgttttaggatgttcatcgactcttgcaagaggttaagaataatgaaaagttctgaagc |
33218834 |
T |
|
| Q |
196 |
aattggattaggtgagact |
214 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33218835 |
aattggattaggtgagact |
33218853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 127 - 201
Target Start/End: Complemental strand, 43391921 - 43391847
Alignment:
| Q |
127 |
ttattgttgttgttttaggatgttcatcgactcttgcaagaggttaagaataatgaaaagttctgaagcaattgg |
201 |
Q |
| |
|
||||| |||||||||||||||||||| || |||||||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
43391921 |
ttatttttgttgttttaggatgttcactgagtcttgcaagaggttgaggataatgaagagttctgaagcaattgg |
43391847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University