View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14356_high_44 (Length: 227)
Name: NF14356_high_44
Description: NF14356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14356_high_44 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 20 - 205
Target Start/End: Original strand, 34818605 - 34818790
Alignment:
| Q |
20 |
attacgccagagacatatgtccaattttagcatctgaattacaattatgcttcaaaattcaaataggattacaattccggtggaaaggactatgtgaccn |
119 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
34818605 |
attacgccggagacagatgtccaattttagcatctgaattacaattatgcttcaaaattcaaataggatcacaattccggtggaaaggactatatgacca |
34818704 |
T |
|
| Q |
120 |
nnnnnntaaatgtactcattgattacattgccttgaattatatatatttaatgtaaagtcaacatatcacttaagtttgacatgtc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34818705 |
aaaaaataaatgtactcattgattacattgccttgaattatatatatttaatgtaaagtcaacatatcacttaagtttgacatgtc |
34818790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University