View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14356_high_47 (Length: 214)
Name: NF14356_high_47
Description: NF14356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14356_high_47 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 13 - 137
Target Start/End: Complemental strand, 7321165 - 7321041
Alignment:
| Q |
13 |
attatactttggtgattaatatttgaatcttaaaccatatgagtgtggtgtctcctaatctccatccaaaggtgcaggtgcaatcttggtgctactttgg |
112 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7321165 |
attatactttagtgattactatttgaatcttaaaccatatgagtgtggtgtctcctaatctccatccaaaggtgcaggtgcaatcttggtgctactttgg |
7321066 |
T |
 |
| Q |
113 |
attatataaagaataccacaaccag |
137 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
7321065 |
attatataaagaataccacaaccag |
7321041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University