View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14356_low_15 (Length: 363)
Name: NF14356_low_15
Description: NF14356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14356_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 140 - 354
Target Start/End: Original strand, 4820578 - 4820789
Alignment:
| Q |
140 |
ctggcttgtatggccagtagtattatgcctctctatgctcctgccgtgttacacagggagagttttgtaagaaatagaatataaaatgggtatgtgacca |
239 |
Q |
| |
|
||||||||||||||||||| |||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4820578 |
ctggcttgtatggccagta---ttatgcctttctgtgctcctgccgtgttacacagggagagttttgtaagaaatagaatataaaatgggtatgtgacca |
4820674 |
T |
|
| Q |
240 |
tagcttaactttaaccaactccaaaccaatactaaaatattagtatatctttttgattaattaaacatgtgtcataaattcgttcgaactccttacacga |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4820675 |
tagcttaactttaaccaactccaaaccaatactaaaatattagtatatctttttgattaattaaacatgtgtcataaattcgttcgaactccttacacga |
4820774 |
T |
|
| Q |
340 |
attcttaagaataat |
354 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
4820775 |
attcttaagaataat |
4820789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 4820462 - 4820534
Alignment:
| Q |
1 |
tggtttgcaatttaccttgtcattgttatcattgtttcggggcaaggtgctttatcttcagttcttttctgct |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4820462 |
tggtttgcaatttaccttgtcattgttatcattgtttcggggcaaggtgctttatgttcagttcttttctgct |
4820534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 235 - 285
Target Start/End: Original strand, 4810719 - 4810769
Alignment:
| Q |
235 |
gaccatagcttaactttaaccaactccaaaccaatactaaaatattagtat |
285 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
4810719 |
gaccttagcttaactttaaccaacttcaaaccaataataaaatattagtat |
4810769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University