View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14356_low_16 (Length: 352)
Name: NF14356_low_16
Description: NF14356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14356_low_16 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 1 - 352
Target Start/End: Original strand, 32860799 - 32861150
Alignment:
| Q |
1 |
tcatcacttgaaaccccttcacagtgaaccagtacttgcggtactggctgaccttgttgaagtaaaatgcaagattgtagaatggattttgcctctagta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32860799 |
tcatcacttgaaaccccttcacagtgaacgagtacttgcggtactgcctgaccttgttgaagtaaaatgcaagattgtagaatggattttgcctctagta |
32860898 |
T |
 |
| Q |
101 |
ttggaccttgctcacttgttaacaaaggttttaataagaaaatgcgaaaaacacagatgtattttagcagctgatggcagcaacaatttatatgtaactg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32860899 |
ttggaccttgctcacttgttaacaaaggttttaataagaaaatgcgaaaaacacagatgtattttagcagctgatggcagcaacaatttatatgtaactg |
32860998 |
T |
 |
| Q |
201 |
atcccattttctcaatgactgggaagggaccgaagtagcataaacaagtttctgattgcggctcaatgacaccatgttgatgagaaggctataatttaac |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
32860999 |
atcccattttctcaatgactgggaagggaccgaagtagcataaacaagtttctgattacggctcagtgacaccatgttgacgagaaggctataatttaac |
32861098 |
T |
 |
| Q |
301 |
caacaccatattcccaatttggaactcacaggaacacagaggccttagcttg |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32861099 |
caacaccatattcccaatttggaactcacaggaacacagaggccttagcttg |
32861150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University