View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14356_low_17 (Length: 346)
Name: NF14356_low_17
Description: NF14356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14356_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 18 - 345
Target Start/End: Complemental strand, 18498968 - 18498623
Alignment:
| Q |
18 |
aacctgacttgcttttacctctttactcaaatccttcatgggtactccttcctttccttttttaaaccgcaacaacaa------------------tatt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |||| |
|
|
| T |
18498968 |
aacctgacttgcttttacctctttactcaaatccttcatgggtactccttcctttccttttttaaagagaaacaacaaaaggtagagtaacattggtatt |
18498869 |
T |
 |
| Q |
100 |
ttatagaatctccaaaagtacttgcatcttattaaccttgctatctttctttttcggtttctcagctttcacaattaaacgggtaggttcactaacctgc |
199 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18498868 |
ttctagaatctccaaaagtacttgcatcttattaatcttgctatctttctttttcggtttctcagctttcacaattaaacgggtaggttcactaacctgc |
18498769 |
T |
 |
| Q |
200 |
tgctttggcttaccactgaccttttccatcggttacttcctgaccaagctttccatctacaaccatcttgcacacttctcttcttaagctcctaatgtta |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18498768 |
tgctttggcttaccactgaccttttccatcggttacttcctgaccaagctttccatctacaaccatcttgcacacttctcttcttaagctcccaatgtta |
18498669 |
T |
 |
| Q |
300 |
gcgagttgagtggaaatctacccaatctaaatctctagattttaga |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18498668 |
gcgagttgagtggaaatctacccaatctaaatctctagattttaga |
18498623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University