View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14356_low_19 (Length: 337)

Name: NF14356_low_19
Description: NF14356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14356_low_19
NF14356_low_19
[»] chr8 (1 HSPs)
chr8 (279-320)||(3001509-3001550)


Alignment Details
Target: chr8 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 279 - 320
Target Start/End: Original strand, 3001509 - 3001550
Alignment:
279 ttttcattgagataatattatattggtcttatggacgatatt 320  Q
    ||||||||||||||||||||||||||||||||||||||||||    
3001509 ttttcattgagataatattatattggtcttatggacgatatt 3001550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University