View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14356_low_27 (Length: 301)
Name: NF14356_low_27
Description: NF14356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14356_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 3e-45; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 88 - 180
Target Start/End: Original strand, 4350442 - 4350534
Alignment:
| Q |
88 |
gttcattgaaaatgggaagaggaaaattcaagagcaagcccactggtcgccgccagttttctacccaggaagacattcgtaagcccttctcca |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4350442 |
gttcattgaaaatgggaagaggaaaattcaagagcaagcccactggtcgccgccagttttctacccaggaagacattcgtaagcccttctcca |
4350534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 99 - 163
Target Start/End: Complemental strand, 34716975 - 34716911
Alignment:
| Q |
99 |
atgggaagaggaaaattcaagagcaagcccactggtcgccgccagttttctacccaggaagacat |
163 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| | ||||||||||| |||||||| |
|
|
| T |
34716975 |
atgggaagaggaaaattcaaggctaagcccactggtcgccgcaacttttctacccatgaagacat |
34716911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University