View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14356_low_30 (Length: 291)
Name: NF14356_low_30
Description: NF14356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14356_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 23 - 275
Target Start/End: Original strand, 12883374 - 12883626
Alignment:
| Q |
23 |
cacagaggagataaatgcctaaataggtttaaagcaaggagaccgtctagctttgtttttctttcttcttgtagcagaaggttttatcggtttgatgagt |
122 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12883374 |
cacagaggagataaatacctaaataggtttaaagcaaggagactgtctagcttcgtttttctttcttcttgtagcagaaggttttattggtttgatgagt |
12883473 |
T |
|
| Q |
123 |
aatgtggtcaatcgaagtttgtttagaggttttgaggttggccgaagtgggttggtgatatctcatcttcaatatacacatgatactctttgtatatgag |
222 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
12883474 |
aatgcggtcaatcgaagtttctttagaggttttgaggttggccgaagtgggttggtgatatctcatcttcaatatgcacatgatactctttgtacttgag |
12883573 |
T |
|
| Q |
223 |
aagcatcggtagaaaatttatggacattgaaggcgttgcttagaggttttgag |
275 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12883574 |
aagcatcggtggaaaatttatggacattgaaggcgttgcttagaggttttgag |
12883626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 223 - 275
Target Start/End: Complemental strand, 42775259 - 42775207
Alignment:
| Q |
223 |
aagcatcggtagaaaatttatggacattgaaggcgttgcttagaggttttgag |
275 |
Q |
| |
|
||||| |||| |||||||| ||||| ||||| ||||||||||||||||||||| |
|
|
| T |
42775259 |
aagcaacggtggaaaatttgtggactttgaaagcgttgcttagaggttttgag |
42775207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 229 - 275
Target Start/End: Original strand, 9296541 - 9296587
Alignment:
| Q |
229 |
cggtagaaaatttatggacattgaaggcgttgcttagaggttttgag |
275 |
Q |
| |
|
||||||| ||||||||||| |||||||| ||||||||||| |||||| |
|
|
| T |
9296541 |
cggtagagaatttatggaccttgaaggctttgcttagaggctttgag |
9296587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 155 - 247
Target Start/End: Original strand, 13102161 - 13102252
Alignment:
| Q |
155 |
tgaggttggccgaagtgggttggtgatatctcatcttcaatatacacatgatactctttgtatatgagaagcatcggtagaaaatttatggac |
247 |
Q |
| |
|
||||||||| | || ||||||||||||||||||||| |||||| | |||||||| ||| || |||||| |||| | |||||||||||||| |
|
|
| T |
13102161 |
tgaggttgggcaaaatgggttggtgatatctcatctacaatatgccgatgatactattttcattggagaagtatcgat-gaaaatttatggac |
13102252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University