View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14356_low_32 (Length: 288)
Name: NF14356_low_32
Description: NF14356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14356_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 17 - 275
Target Start/End: Complemental strand, 12886112 - 12885854
Alignment:
| Q |
17 |
attcttcatcccatcaagttgcttttctaatccatctttatcagattcagttttctgaagctttgttttcaactcagtaatgtaagatatagcatcaccc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12886112 |
attcttcatcccatcaagttgcttttctaatccatctttatcagattcagttttctgaagctttgttttcaactcagtaatgtaagatatagcatcaccc |
12886013 |
T |
|
| Q |
117 |
aaaagtgaagctttgtccatctttgaaacattaggaacaaccgctcgaagtgcatagaatctctgattcagcttctctcttctttgcctctcagcttcaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12886012 |
aaaagtgaagctttgtccatctttgaaacattaggaacaaccgctcgaagtgcatagaatctctgattcagcttctctcttctttgcctctcagcttcaa |
12885913 |
T |
|
| Q |
217 |
catgattcaacggttcctctcttccgtttgccggcttcctccctctcttcctcggcttc |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12885912 |
catgattcaacggttcctctcttccgtttgccggcttcctccctctcttcctcggcttc |
12885854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 99 - 241
Target Start/End: Complemental strand, 28081244 - 28081102
Alignment:
| Q |
99 |
taagatatagcatcacccaaaagtgaagctttgtccatctttgaaacattaggaacaaccgctcgaagtgcatagaatctctgattcagcttctctcttc |
198 |
Q |
| |
|
|||||||||||||| || | || || |||||||||||||| |||||||| ||||| || || || || ||||||||| | || || ||||| ||||||| |
|
|
| T |
28081244 |
taagatatagcatcgcctagcagcgatgctttgtccatcttagaaacatttggaaccacagcacgtagagcatagaatttttggttaagcttttctcttc |
28081145 |
T |
|
| Q |
199 |
tttgcctctcagcttcaacatgattcaacggttcctctcttcc |
241 |
Q |
| |
|
|||| ||||| ||||| ||||||||||| ||||| |||||||| |
|
|
| T |
28081144 |
tttgtctctctgcttctacatgattcaatggttcttctcttcc |
28081102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 105 - 275
Target Start/End: Complemental strand, 38660704 - 38660534
Alignment:
| Q |
105 |
atagcatcacccaaaagtgaagctttgtccatctttgaaacattaggaacaaccgctcgaagtgcatagaatctctgattcagcttctctcttctttgcc |
204 |
Q |
| |
|
|||||||| || | ||| ||||| |||||||| || |||| ||||||||||| |||| | || || |||||||| || |||||||| | |||||||| |
|
|
| T |
38660704 |
atagcatcgccaagaagagaagccttgtccattttagaaatgttaggaacaacagctcttaaggcgtaaaatctctggttaagcttctcccgtctttgcc |
38660605 |
T |
|
| Q |
205 |
tctcagcttcaacatgattcaacggttcctctcttccgtttgccggcttcctccctctcttcctcggcttc |
275 |
Q |
| |
|
|||| |||||||||||||||| |||||||||| |||||| || ||||| |||||||| || || |||||| |
|
|
| T |
38660604 |
tctccgcttcaacatgattcagtggttcctctcgtccgttggcaggctttctccctctttttctaggcttc |
38660534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University