View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14356_low_36 (Length: 258)
Name: NF14356_low_36
Description: NF14356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14356_low_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 124 - 242
Target Start/End: Complemental strand, 34101786 - 34101668
Alignment:
| Q |
124 |
cctctgctaagtaaaccttcgttatatttctgcaacatatcatcaatttcttccacatatgtttctttcggcggtggcaaaacagaattagccgtagaat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34101786 |
cctctgctaagtaaaccttcgttatatttctgcaacatatcatcaatttcttccacatatgtttctttcggcggtggcaaaacagaattagccgtagaat |
34101687 |
T |
 |
| Q |
224 |
tttcagcgaatcttccaac |
242 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
34101686 |
tttcagcgaatcttccaac |
34101668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University