View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14356_low_39 (Length: 250)
Name: NF14356_low_39
Description: NF14356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14356_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 7 - 247
Target Start/End: Complemental strand, 3374091 - 3373851
Alignment:
| Q |
7 |
gattgatatttaattttaggaattatagtaaggaacaaaattcacgggtacaaccattgaatatgaatgctttgcagcttcagagagatagcctggcatt |
106 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
3374091 |
gattgatatttaatattaggaattatagtaaggaacaaaattcacgggtacaaccattgaatatgaatgctttgcagcttcagaaagatagtctggcatt |
3373992 |
T |
 |
| Q |
107 |
tgagctcctgcggacacatggcttcaaagtgtcaccatgtatgatctttaagcgttattattttttaattaaaagattctgtaaatcccaaaactaaaaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3373991 |
tgagctcctgcggacacatggcttcaaagtgtcaccatgtatgatctttaagcgttattattttttaattaaaagattctgtaaatcccaaaactataaa |
3373892 |
T |
 |
| Q |
207 |
tttttggacaagaaaatgtaacgtgtcactaaatattcttc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3373891 |
tttttggacaagaaaatgtaacgtgtcactaaattttcttc |
3373851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 66 - 154
Target Start/End: Complemental strand, 3347622 - 3347534
Alignment:
| Q |
66 |
aatatgaatgctttgcagcttcagagagatagcctggcatttgagctcctgcggacacatggcttcaaagtgtcaccatgtatgatctt |
154 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||||||| |||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
3347622 |
aatatgaatgctttgcagcttcagaaagatagtctggcatttgagctccttaggacacatggatttaaagtatcaccatgtatgatctt |
3347534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University