View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14356_low_52 (Length: 211)
Name: NF14356_low_52
Description: NF14356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14356_low_52 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 128 - 199
Target Start/End: Original strand, 9756229 - 9756300
Alignment:
| Q |
128 |
gggtttgattcaagctgattggaacagaattcgaacagaagaagggttggattcaagctgatttgttttctg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9756229 |
gggtttgattcaagctgattggaacagaattcaaatagaagaagggttggattcaagctgatttgttttctg |
9756300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 132 - 199
Target Start/End: Complemental strand, 51675792 - 51675726
Alignment:
| Q |
132 |
ttgattcaagctgattggaacagaattcgaacagaagaagggttggattcaagctgatttgttttctg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
51675792 |
ttgattcaagctgattggaacagaattcgaacagaagaa-ggttggattcaagctgatttattttctg |
51675726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 128 - 190
Target Start/End: Complemental strand, 5576069 - 5576007
Alignment:
| Q |
128 |
gggtttgattcaagctgattggaacagaattcgaacagaagaagggttggattcaagctgatt |
190 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
5576069 |
gggtttgattcaagctgattggaacataaatcgaacagaagaagggttggattcaagctgatt |
5576007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University