View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14357_high_9 (Length: 236)
Name: NF14357_high_9
Description: NF14357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14357_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 16 - 223
Target Start/End: Original strand, 36942773 - 36942980
Alignment:
| Q |
16 |
caaactccacagcaacaaatggattatcagttgagttcaacctttggttatcaagtgttagacccatagaaccaccttttgttgcattaggcttttttga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36942773 |
caaactccacagcaacaaatggattatcagttgagttcaacctttgattatcaagtgttagacccatagaaccaccttttgttgcattaggcttttttga |
36942872 |
T |
|
| Q |
116 |
accataaggggctaggaagaatgcaatcccatctccatacatttgtctattctgtgaatctattgtaaatgtgaaatgagatgtgaaatctgtgagattg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36942873 |
accataaggggctaggaagaatgcaatcccatctccatacatttgtctattctgtgaatctattgtaaatgtgaaatgagatgtgaaatctgtgagattg |
36942972 |
T |
|
| Q |
216 |
tttgtgat |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
36942973 |
tttgtgat |
36942980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University