View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14358_high_6 (Length: 266)
Name: NF14358_high_6
Description: NF14358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14358_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 1539714 - 1539776
Alignment:
| Q |
18 |
aggggcgatagacactgtaaacaaaaacaattattcatcactgtcatatcacaaacctaggat |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1539714 |
aggggcgatagacactgtaaacaaaaacaattattcatcactgtcatgtcacaaacctaggat |
1539776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 203 - 248
Target Start/End: Original strand, 1539773 - 1539818
Alignment:
| Q |
203 |
ggattagaagtgtcctggtgtcagacacacggactgacgccgagac |
248 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
1539773 |
ggattagaagtgtcccagtgtcagacacacggaccgacgccgagac |
1539818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University