View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14358_high_7 (Length: 239)
Name: NF14358_high_7
Description: NF14358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14358_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 19 - 225
Target Start/End: Complemental strand, 19567657 - 19567451
Alignment:
| Q |
19 |
agatattgatagaaaagcttctgatttcattgctaaatattatgctactagagtcactaactctcaaagccaatttgcatcatgaaaattggatttctac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19567657 |
agatattgatagaaaagcttctgatttcattgctaaatattatgctactagagtcactaactctcaaagccaatttgcatcatgaaaattggatttctac |
19567558 |
T |
 |
| Q |
119 |
attgcttatgattatgaattccattcttgcaaggaattatttccatatttttctctcttttaattggaccaatatggatccaatagttaattcttaggta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19567557 |
attgcttatgattatgaattccattcttgcaaggaattatttccatatttttctctcttttaattggaccaatatggatccaatagttaattcttaggta |
19567458 |
T |
 |
| Q |
219 |
gaataat |
225 |
Q |
| |
|
|||||| |
|
|
| T |
19567457 |
aaataat |
19567451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 22 - 96
Target Start/End: Complemental strand, 19574979 - 19574905
Alignment:
| Q |
22 |
tattgatagaaaagcttctgatttcattgctaaatattatgctactagagtcactaactctcaaagccaatttgc |
96 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||| || || ||| |||| || ||||||||||||||||||| |
|
|
| T |
19574979 |
tattgataggaaagcttctgatttcattgctagatactacgcgactcgagttaccgactctcaaagccaatttgc |
19574905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University