View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14358_high_8 (Length: 238)
Name: NF14358_high_8
Description: NF14358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14358_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 28146942 - 28146738
Alignment:
| Q |
1 |
tataatggatggaacattattacggtgaaaaatcgtggagaattacatttgtaaagttaatatctcaagaaataattgtagttaggaagaaaattttcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28146942 |
tataatggatggaacattattacggtgaaaaatcgtggagaattacatctgtaaagttaatatcccaagaaataattgtagttaggaagaaaattttcat |
28146843 |
T |
 |
| Q |
101 |
cttaacaatcaaatgattgatgctaaattatatttataactaaattatatttctcttttgctcacattatttcnnnnnnnagattaattcttcatcgtct |
200 |
Q |
| |
|
||||||||||||||||| ||| ||||||||| ||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
28146842 |
cttaacaatcaaatgatcgatactaaattat-----------------atttctcttttgctcacattatttctttttttagattaattcttcattgtct |
28146760 |
T |
 |
| Q |
201 |
aagaggaaattgcacacaatct |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
28146759 |
aagaggaaattgcacacaatct |
28146738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University