View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14358_low_11 (Length: 266)

Name: NF14358_low_11
Description: NF14358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14358_low_11
NF14358_low_11
[»] chr2 (2 HSPs)
chr2 (18-80)||(1539714-1539776)
chr2 (203-248)||(1539773-1539818)


Alignment Details
Target: chr2 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 1539714 - 1539776
Alignment:
18 aggggcgatagacactgtaaacaaaaacaattattcatcactgtcatatcacaaacctaggat 80  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
1539714 aggggcgatagacactgtaaacaaaaacaattattcatcactgtcatgtcacaaacctaggat 1539776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 203 - 248
Target Start/End: Original strand, 1539773 - 1539818
Alignment:
203 ggattagaagtgtcctggtgtcagacacacggactgacgccgagac 248  Q
    |||||||||||||||  ||||||||||||||||| |||||||||||    
1539773 ggattagaagtgtcccagtgtcagacacacggaccgacgccgagac 1539818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University