View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14359_high_30 (Length: 297)
Name: NF14359_high_30
Description: NF14359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14359_high_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 279
Target Start/End: Complemental strand, 530256 - 529978
Alignment:
| Q |
1 |
atacaagttattttcttgcttaggatcattggtctcagccaaaaatggtaaactataatttgcattgatatcattgcttttgggataaaactcatagttg |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
530256 |
atacaagttattttcttgctcaggatcattggtctcagccaaaaatgataaactataatttgcattgatatcattgcttttgggataaaactcatagttg |
530157 |
T |
|
| Q |
101 |
aattgccccctaccaccaacaacaatctgactaccattagggaggatatggctggtggcataccatctctcggcagaaagtccgccgtcgatttcactcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
530156 |
aattgccccctaccaccaacaacaatctgactaccattagggaggatatggctggtggcataccatctctcggcagaaagtccgccgtcgatttcactcc |
530057 |
T |
|
| Q |
201 |
aatcacatgtcgggcaaggactatagattcgtatgttgcgatttccatcgttgtagccaccggtttgaacgagtgatcc |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
530056 |
aatcacatgtcgggcaaggactatagattcgtatgttgcgatttccatcgttgtagccaccggtttgaacgagtgatcc |
529978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University