View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14359_high_31 (Length: 292)
Name: NF14359_high_31
Description: NF14359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14359_high_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 277
Target Start/End: Original strand, 35170056 - 35170332
Alignment:
| Q |
1 |
aagtatttgcattgacggtttatcaaagctaaacacgtccaagtatgagctagtgatggttttgatatgattttgtacttcacatatccaggtgaagatc |
100 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35170056 |
aagtatttgcattgacggtgtatcaaagttaaacacgtccaagtatgagctagtgatggttttgatatgattttgtacttcacatatccaggtgaagatc |
35170155 |
T |
 |
| Q |
101 |
ctatttcagctcataacagatatccagaactatgggccaaaatcaacagagagattgtggaagaatggaaaagtaaatccttggacaatttgaaggaaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35170156 |
ctatttcagctcataacagatatccagaactatgggccaaaatcaatagagagattgtggaagaatggaaaagtaaatccttggacaatttgaaggaaga |
35170255 |
T |
 |
| Q |
201 |
acaagaagatggcttggttttcttcatgagggctggttttagagatagtcccaagtggggaatgctattttgggaag |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35170256 |
acaagaagatggcttggttttcttcatgagggctggttttagagatagtcccaagtggggaatgctattttgggaag |
35170332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University