View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14359_high_35 (Length: 276)
Name: NF14359_high_35
Description: NF14359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14359_high_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 118 - 257
Target Start/End: Original strand, 15672188 - 15672327
Alignment:
| Q |
118 |
ttcgtttcgcaccaaagagtatttctcttatcacttttcattttctcttaaatacattccccaatttcttcatgggtttgattttataccgatttctagt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15672188 |
ttcgtttcgcaccaaagagtatttctcttatcacttttcattttctcttaaattcattccccaatttcttcatgggtttgattttataccgatttctagt |
15672287 |
T |
|
| Q |
218 |
tttcattcctctgtttaaccaatcttcaagccctaaaatt |
257 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15672288 |
tttcattcctctgtttaaccgatcttcaagccctaaaatt |
15672327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 14 - 51
Target Start/End: Original strand, 15672150 - 15672187
Alignment:
| Q |
14 |
ataattctggagaatgttgattccagattgagtggaac |
51 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15672150 |
ataattttggagaatgttgattccagattgagtggaac |
15672187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University