View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14359_high_45 (Length: 238)
Name: NF14359_high_45
Description: NF14359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14359_high_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 41570788 - 41570568
Alignment:
| Q |
1 |
caattttgttaccgctcaaatctagttcttgaaatctatttgattcgggaaatacattcggaatttgaccgcttatgagtgaattatctttgagagacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41570788 |
caattttgttaccgctcaaatctagttcttgaaatctatttgattcgggaaatacattcggaattagaccgcttatgagtgaattatctttgagagacaa |
41570689 |
T |
 |
| Q |
101 |
aaatgttagatttggaaggattaaaagaaaggatgggattgaaccattaaggttgttctctatgagacttagggaagtaaaatatgtgaggttagagaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41570688 |
aaatgttagatttggaaggattaaaagaaaggatgggattgaaccattaaggttgttctctatgagacttagggaagtaaaatatgtgaggttagagaaa |
41570589 |
T |
 |
| Q |
201 |
gaaagaggaattggccctttg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41570588 |
gaaagaggaattggccctttg |
41570568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 130 - 219
Target Start/End: Original strand, 12249781 - 12249870
Alignment:
| Q |
130 |
aggatgggattgaaccattaaggttgttctctatgagacttagggaagtaaaatatgtgaggttagagaaagaaagaggaattggccctt |
219 |
Q |
| |
|
|||| ||||||||||||||||| | ||| ||| |||||||| |||| ||| || ||||| |||||| || || |||||||||||||||| |
|
|
| T |
12249781 |
aggaggggattgaaccattaagttggttttctgagagacttatggaattaagatgtgtgaagttagaaaaggacagaggaattggccctt |
12249870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University