View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14359_high_45 (Length: 238)

Name: NF14359_high_45
Description: NF14359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14359_high_45
NF14359_high_45
[»] chr5 (1 HSPs)
chr5 (1-221)||(41570568-41570788)
[»] chr2 (1 HSPs)
chr2 (130-219)||(12249781-12249870)


Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 41570788 - 41570568
Alignment:
1 caattttgttaccgctcaaatctagttcttgaaatctatttgattcgggaaatacattcggaatttgaccgcttatgagtgaattatctttgagagacaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
41570788 caattttgttaccgctcaaatctagttcttgaaatctatttgattcgggaaatacattcggaattagaccgcttatgagtgaattatctttgagagacaa 41570689  T
101 aaatgttagatttggaaggattaaaagaaaggatgggattgaaccattaaggttgttctctatgagacttagggaagtaaaatatgtgaggttagagaaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41570688 aaatgttagatttggaaggattaaaagaaaggatgggattgaaccattaaggttgttctctatgagacttagggaagtaaaatatgtgaggttagagaaa 41570589  T
201 gaaagaggaattggccctttg 221  Q
    |||||||||||||||||||||    
41570588 gaaagaggaattggccctttg 41570568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 130 - 219
Target Start/End: Original strand, 12249781 - 12249870
Alignment:
130 aggatgggattgaaccattaaggttgttctctatgagacttagggaagtaaaatatgtgaggttagagaaagaaagaggaattggccctt 219  Q
    |||| ||||||||||||||||| | ||| |||  |||||||| |||| ||| || ||||| |||||| || || ||||||||||||||||    
12249781 aggaggggattgaaccattaagttggttttctgagagacttatggaattaagatgtgtgaagttagaaaaggacagaggaattggccctt 12249870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University