View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14359_high_50 (Length: 212)
Name: NF14359_high_50
Description: NF14359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14359_high_50 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 35769432 - 35769643
Alignment:
| Q |
1 |
tgattattttaaaattttgttgatttctagaacaaactattcgactcctgaatttcaaagactaaattggtgactcactcttgtttagatggtttctgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
35769432 |
tgattattttaaaattttgttgatttctagaacaaactgttcgactcctgaatttcaaagactaaattggtgactcactcttgtttagatggtttctaca |
35769531 |
T |
 |
| Q |
101 |
acaacagcaaaaaatcatccttttagtaataatcaatctaccgatggacagaagaaacatgtttctttattgtagcaactgtttaaaagtgatgcaaaaa |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35769532 |
acaacaacaaaaaatcatccttttagtaataatcaatttaccgatggacagaagaaacatgtttctttattgtagccactgtttaaaagtgatgcaaaaa |
35769631 |
T |
 |
| Q |
201 |
gcaaaggcttat |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
35769632 |
gcaaaggcttat |
35769643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University