View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14359_low_27 (Length: 351)
Name: NF14359_low_27
Description: NF14359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14359_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 16 - 331
Target Start/End: Original strand, 38858439 - 38858754
Alignment:
| Q |
16 |
gaatattggcgcccaaaaattatttttgttacagctagtagcaatggaaacctatttgcatcgatgctacaacaaacaaatcaacgtttgatcgagcttt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38858439 |
gaatattggcgcccaaaaattatttttgttacagctagtagcattggaaacctatttgcatcgatgctacaacaaacaaatcaacgtttgatcgagcttt |
38858538 |
T |
 |
| Q |
116 |
tgctaattttgtccgtgtgtttatagacatgggttttactaagcaagtgagatataaggtcttggttggaaggaagggtttttagtttttgccaaaatgg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38858539 |
tgctaattttgtccgtgtgtttatagacatgggttttactaagcaagtgagatataaggtcttggttggaaggaagggtttttcgtttttgccaaaatgg |
38858638 |
T |
 |
| Q |
216 |
attttgaatacacctacttgatttttgttcatattgcaaatgtactggtcactttatggacaattgcaaaagagtcaatgttatctcccctaatcaggta |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38858639 |
attttgaatacacctacttgatttttgttcatattgcaaatgtactggtcactttatggacaattgcaaaagagtcaatgttatctcccctaatcaggta |
38858738 |
T |
 |
| Q |
316 |
gaacttgtaagcgtag |
331 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
38858739 |
gaacctgtaagcgtag |
38858754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University