View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14359_low_36 (Length: 289)
Name: NF14359_low_36
Description: NF14359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14359_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 14 - 205
Target Start/End: Original strand, 29163643 - 29163834
Alignment:
| Q |
14 |
atatatagcatcaacaacaagtgcatgttttctcatttaannnnnnngggcacttaactgtccaccaaagcatagtgtggaactaacagctcgggggttg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29163643 |
atatatagcatcaacaacaagtgcatgttttctcatttaatttttttgggcacttaactgtccaccaaaacatagtgtggaactaacagctcgggggttg |
29163742 |
T |
 |
| Q |
114 |
acacgtgaattattattgactttcttttggtttcttatgccatgccttgtggaaagttgtagaaataattttgtttgtgcc-tagtttttaac |
205 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
29163743 |
acacgtgaattattattgac-ttcttttggtttcttatgccatgccttgtggaaagttgcagaaataattttgtttgtgccttagtttttaac |
29163834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 29164550 - 29164602
Alignment:
| Q |
222 |
tttttggttacgacataagtggttaataacatgcataatttggtaaacaaagt |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29164550 |
tttttggttacgacataagtggttaataacatgcataatttggtaaacaaagt |
29164602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University