View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14359_low_37 (Length: 278)
Name: NF14359_low_37
Description: NF14359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14359_low_37 |
 |  |
|
| [»] scaffold0039 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 17 - 268
Target Start/End: Complemental strand, 43102448 - 43102197
Alignment:
| Q |
17 |
caacctcttcattgtgttgttcctcatcgcttatgtttggttaacgggcttacaccgcacaacttggacagcaccaagccaggagtgtctcaccggctgg |
116 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43102448 |
caacctcttcattgtattgttcctcatcgcttatgtttggttaacgggcttacaccgcacaacttggacagcaccaagtcaggagtgtctcaccggctgg |
43102349 |
T |
 |
| Q |
117 |
aagcctttactccgacttgccacgccaagctgcgtttccgtttgtttggaatggtggtggtatgaagtaatgatcattttatgtggtttacttgtggacc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102348 |
aagcctttactccgacttgccacgccaagctgcgtttccgtttgtttggaatggtggtggtatgaagtaatgatcattttatgtggtttacttgtggacc |
43102249 |
T |
 |
| Q |
217 |
ccaccgtaaccattgcttctatcgggattctaattcaaactacttcattcat |
268 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102248 |
ccaccgttaccattgcttctatcgggattctaattcaaactacttcattcat |
43102197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 141 - 182
Target Start/End: Original strand, 24241 - 24282
Alignment:
| Q |
141 |
ccaagctgcgtttccgtttgtttggaatggtggtggtatgaa |
182 |
Q |
| |
|
|||||||||||||| || || ||||||||||||||||||||| |
|
|
| T |
24241 |
ccaagctgcgtttctgtctgcttggaatggtggtggtatgaa |
24282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 150 - 202
Target Start/End: Original strand, 51874979 - 51875031
Alignment:
| Q |
150 |
gtttccgtttgtttggaatggtggtggtatgaagtaatgatcattttatgtgg |
202 |
Q |
| |
|
||||| |||||||| |||||||||||||||||| | ||||| ||||| ||||| |
|
|
| T |
51874979 |
gtttctgtttgtttagaatggtggtggtatgaactcatgataattttgtgtgg |
51875031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University