View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14359_low_37 (Length: 278)

Name: NF14359_low_37
Description: NF14359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14359_low_37
NF14359_low_37
[»] chr8 (1 HSPs)
chr8 (17-268)||(43102197-43102448)
[»] scaffold0039 (1 HSPs)
scaffold0039 (141-182)||(24241-24282)
[»] chr3 (1 HSPs)
chr3 (150-202)||(51874979-51875031)


Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 17 - 268
Target Start/End: Complemental strand, 43102448 - 43102197
Alignment:
17 caacctcttcattgtgttgttcctcatcgcttatgtttggttaacgggcttacaccgcacaacttggacagcaccaagccaggagtgtctcaccggctgg 116  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
43102448 caacctcttcattgtattgttcctcatcgcttatgtttggttaacgggcttacaccgcacaacttggacagcaccaagtcaggagtgtctcaccggctgg 43102349  T
117 aagcctttactccgacttgccacgccaagctgcgtttccgtttgtttggaatggtggtggtatgaagtaatgatcattttatgtggtttacttgtggacc 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43102348 aagcctttactccgacttgccacgccaagctgcgtttccgtttgtttggaatggtggtggtatgaagtaatgatcattttatgtggtttacttgtggacc 43102249  T
217 ccaccgtaaccattgcttctatcgggattctaattcaaactacttcattcat 268  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||    
43102248 ccaccgttaccattgcttctatcgggattctaattcaaactacttcattcat 43102197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0039 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0039
Description:

Target: scaffold0039; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 141 - 182
Target Start/End: Original strand, 24241 - 24282
Alignment:
141 ccaagctgcgtttccgtttgtttggaatggtggtggtatgaa 182  Q
    |||||||||||||| || || |||||||||||||||||||||    
24241 ccaagctgcgtttctgtctgcttggaatggtggtggtatgaa 24282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 150 - 202
Target Start/End: Original strand, 51874979 - 51875031
Alignment:
150 gtttccgtttgtttggaatggtggtggtatgaagtaatgatcattttatgtgg 202  Q
    ||||| |||||||| |||||||||||||||||| | ||||| ||||| |||||    
51874979 gtttctgtttgtttagaatggtggtggtatgaactcatgataattttgtgtgg 51875031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University