View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14359_low_38 (Length: 276)
Name: NF14359_low_38
Description: NF14359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14359_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 20 - 82
Target Start/End: Original strand, 50899826 - 50899888
Alignment:
| Q |
20 |
ttgtggagtgatttacagtaattgatttcgacagaaatattgtcgtaagagaaacaatgcagg |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
50899826 |
ttgtggagtgatttacagtaattgatttcgacataaatattgtcgtaagagaaacaatgcagg |
50899888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University