View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14359_low_44 (Length: 246)
Name: NF14359_low_44
Description: NF14359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14359_low_44 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 43369287 - 43369505
Alignment:
| Q |
1 |
ctatcaaaattgtctttattcttcactacgcgtctaatgtttgatctctttactactcttcaaatgtgttttccatgcaaacaatatgacataagagata |
100 |
Q |
| |
|
||||||||||||| |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43369287 |
ctatcaaaattgttgttattctttactactcgtctaatgtttgatctctttactactcttcaaatgtgttttccatgcaaacaatatgacatgagagata |
43369386 |
T |
|
| Q |
101 |
gatctttaagttctttaattatttgatttagagtttgnnnnnnntgccaactactttgaagaacttagtttttaaaattgtgaagagtatcctttgtata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43369387 |
gatctttaagttctttaattatttgatttagagtttg-aaaaaatgccaactactttgaagaacttagtttttaaaattgtgaagagtatcctttgtata |
43369485 |
T |
|
| Q |
201 |
taaaaaatgtgtacatgtta |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
43369486 |
taaaaaatgtgtacatgtta |
43369505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University