View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14359_low_45 (Length: 240)
Name: NF14359_low_45
Description: NF14359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14359_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 35769215 - 35769424
Alignment:
| Q |
1 |
ataggttgaccgattaaaaagactaacatgattctgaacatggtgtgacaaaaatggtagatgtttggagtcacttaatcatttggtcagccgatcaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35769215 |
ataggttgaccgattaaaaagactaacatgattctgaacatggtgtgacaaaaatggtagatgtttggagtcacttaatcatttggtcagccgatcaatc |
35769314 |
T |
 |
| Q |
101 |
actgatcggtgcgtatggaaaagcatttgttgggagaagtctacccattaaatggatctctgtcatcttaaacgattagtcactgcagttgcttggttaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35769315 |
actgatcggtgcgtatggaaaagcatttgttgggagaagtctacccattaaatggatctctgtcatcttaaacgattagtcactgcagttgcttggttaa |
35769414 |
T |
 |
| Q |
201 |
cctgattgaa |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
35769415 |
cctgattgaa |
35769424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 107 - 178
Target Start/End: Original strand, 2025348 - 2025419
Alignment:
| Q |
107 |
cggtgcgtatggaaaagcatttgttgggagaagtctacccattaaatggatctctgtcatcttaaacgatta |
178 |
Q |
| |
|
||||||||||||| ||| ||||||||||||| ||| |||| ||||||| ||||| || |||||||| ||||| |
|
|
| T |
2025348 |
cggtgcgtatggagaagtatttgttgggagatgtcaaccccttaaatgaatctcagttatcttaaaagatta |
2025419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 34338078 - 34338021
Alignment:
| Q |
103 |
tgatcggtgcgtatggaaaagcatttgttgggagaagtctacccattaaatggatctc |
160 |
Q |
| |
|
||||||||| |||||||||| |||||||||||| | ||| |||| ||||||||||||| |
|
|
| T |
34338078 |
tgatcggtgtgtatggaaaaacatttgttgggataggtcaaccccttaaatggatctc |
34338021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 41539004 - 41539057
Alignment:
| Q |
107 |
cggtgcgtatggaaaagcatttgttgggagaagtctacccattaaatggatctc |
160 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
41539004 |
cggtgcgtagggaaaaatatttgttgggagaagtcaaccccttaaatggatctc |
41539057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University