View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14359_low_50 (Length: 237)
Name: NF14359_low_50
Description: NF14359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14359_low_50 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 5 - 221
Target Start/End: Complemental strand, 30432159 - 30431933
Alignment:
| Q |
5 |
agatcttagagtgagggatatccgggtggttaatgtgagtttatcggataaatggagatggatgttattggacgggaaggggctctttggaaagatgcgc |
104 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||||| || |||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30432159 |
agatcttagagtgagtgatatccgggtggttaatgtaagtttattggctaaatggagatgaatgttattggacgggaaggggctctttggaaagatgcgc |
30432060 |
T |
|
| Q |
105 |
taatagagaaatatggttttggagtga----------cgaggtggggatgtggagtggccgagacatacatcaaggtggtggaaaaatattgttaattta |
194 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30432059 |
taatagagaaatatggttttggagtgatgaggtggatggaggtggagatgtggagtggccgagacatacatcaaggtagtggaaaaatattgttaatttt |
30431960 |
T |
|
| Q |
195 |
gatatgtttggtgggcaaggttggttt |
221 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
30431959 |
gatatgtttggtgggcaaggttggttt |
30431933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University