View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14359_low_54 (Length: 216)
Name: NF14359_low_54
Description: NF14359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14359_low_54 |
 |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0088 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 20 - 199
Target Start/End: Complemental strand, 49917 - 49738
Alignment:
| Q |
20 |
catttattcgaaattcaaatttatgccattaatgatcacaaaatcgaattgg-acactctgatgacacattgggaacgtagaattaattcaaaacaactt |
118 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49917 |
catttattcgaaattcaa-tttatgccattaatgatcacaaaatcgaattggtacactgtgatgacacattgggaacgtagaattaattcaaaacaactt |
49819 |
T |
 |
| Q |
119 |
aaataaaaacaaatacacaaatgttatgtgattttgagtagacctgttaaagcctaaaacacaaatacacataactcttat |
199 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
49818 |
aattaaaaacaaatacacaaatgttatgtgattttgagtagacctgctaaagcctaaaacacaaatacacataactcttat |
49738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University