View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_high_110 (Length: 240)
Name: NF1435_high_110
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_high_110 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 22198594 - 22198676
Alignment:
| Q |
1 |
ttttcaatttgaagcatgcaattagaagatagcatactaattaatcactagttaattatggtagaaaacatatttaatcacta |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22198594 |
ttttcaatttgaagcatgcaattagaagatagcatactaattaatcactagttaattatggtagaaaacatatttaatcacta |
22198676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 8 - 76
Target Start/End: Original strand, 28829263 - 28829334
Alignment:
| Q |
8 |
tttgaagcatgcaattagaa---gatagcatactaattaatcactagttaattatggtagaaaacatattta |
76 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28829263 |
tttgaagtatgcaattagaagaagatagcatactaattaatcactagttaattatggtagaaaacatattta |
28829334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University