View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1435_high_115 (Length: 238)

Name: NF1435_high_115
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1435_high_115
NF1435_high_115
[»] chr1 (1 HSPs)
chr1 (1-221)||(3356888-3357108)


Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 3357108 - 3356888
Alignment:
1 tgcaccggaggatgtggtatgaatgaggatagagaacatcaatttgttacctgtgatttttatggaaagattcgccaagttgtatgtggttggttaggtt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||    
3357108 tgcaccggaggatgtggtatgaatgaggatagagaacatcaatttgttacatgtgatttttatggaaagattcgccaggttgtatgtggttggttaggtt 3357009  T
101 tttcaactgcagttcaggggaagttgatgggtcatcttgatcagtttagtggcttatgaggctttccaaaacaaatatgcaaggtgtttaacattatttg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
3357008 tttcaactgcagttcaggggaagttgatgggtcatcttgatcagtttagtggcttatgaggctttccaaaataaatatgcaaggtgtttaacattatttg 3356909  T
201 gatttcagttgtttgggttat 221  Q
    |||||||||||||||||||||    
3356908 gatttcagttgtttgggttat 3356888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University