View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_high_117 (Length: 238)
Name: NF1435_high_117
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_high_117 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 103 - 204
Target Start/End: Complemental strand, 10135606 - 10135505
Alignment:
| Q |
103 |
caaatctctcgttacaaattgaataatgtttatcgtgaaatttattggttattggggaggccctaaagccagttttgagagtttaataatttgaatataa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10135606 |
caaatctctcgttacaaattgaataatgtttatcgtgaaatttattggttattggggaggccctaaagccagttttgagagtttaataatttgaatataa |
10135507 |
T |
 |
| Q |
203 |
at |
204 |
Q |
| |
|
|| |
|
|
| T |
10135506 |
at |
10135505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 197 - 238
Target Start/End: Complemental strand, 10135496 - 10135455
Alignment:
| Q |
197 |
atataaattagggtttcatttttgtttggttattgggatggc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10135496 |
atataaattagggtttcatttttgtttggttattgggatggc |
10135455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University