View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_high_118 (Length: 238)
Name: NF1435_high_118
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_high_118 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 152 - 184
Target Start/End: Original strand, 5106437 - 5106469
Alignment:
| Q |
152 |
ttctttgtgtgtcctaaagctacaagatgttgg |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5106437 |
ttctttgtgtgtcctaaagctacaagatgttgg |
5106469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University