View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_high_122 (Length: 236)
Name: NF1435_high_122
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_high_122 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 9587130 - 9587348
Alignment:
| Q |
1 |
acattcctttgtccatttcttctagtccttttctgctttaggattgctttagcctcttagtacataaaaaatgcagagatatgctcgtgccttcttcccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9587130 |
acattcctttgtccatttcttctagtccttttctgctttaggattgctttagcctcttagtacataaaaaatgcagagatatgctcgtgccttcttcccc |
9587229 |
T |
|
| Q |
101 |
cacatacactccttagatattgcccaatcaacatcttctttttggactttgcatcctacctgccgattctcattcccttatttaaatcattttaaatttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9587230 |
cacatacactccttagatattgcccaatcaacatcttctttttggactttgcatcctacctgccgattctcattcccttatttaaatcattttaaatttc |
9587329 |
T |
|
| Q |
201 |
atcatgttacataaagtaa |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
9587330 |
atcatgttacataaagtaa |
9587348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 120 - 185
Target Start/End: Original strand, 55938852 - 55938917
Alignment:
| Q |
120 |
ttgcccaatcaacatcttctttttggactttgcatcctacctgccgattctcattcccttatttaa |
185 |
Q |
| |
|
||||||||||||| ||||| ||||||||||| || | || ||||||||||||||||| || ||||| |
|
|
| T |
55938852 |
ttgcccaatcaacttcttccttttggacttttcaccttagctgccgattctcattcctttttttaa |
55938917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University