View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_high_15 (Length: 498)
Name: NF1435_high_15
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_high_15 |
 | |
|
| [»] scaffold0274 (2 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 392; Significance: 0; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 392; E-Value: 0
Query Start/End: Original strand, 20 - 489
Target Start/End: Original strand, 33368155 - 33368632
Alignment:
| Q |
20 |
aagttattaactttgcttgttgcttcatgtgagctttgttagtactagaatcggtttaccaagtgaacgtcctgattgcaacattgctggttttggttat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33368155 |
aagttattaactttgcttgttgcttcatgcgagctttgttagtactagaatcggtttaccaagtaaacgtcctgattgcaacattgctggttttggttat |
33368254 |
T |
|
| Q |
120 |
atagtggtttgctattttcttttgcttatgaacaagaggggtgtataaccctttggactacggtttaggcagatctcaaatcatgtagttgtttcttctt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33368255 |
atagtggtttgctattttcttttgcttatgaacaagaggggtgtataaccctttggactacggtttaggcagatctcaaatcatgtagttgtttcttctt |
33368354 |
T |
|
| Q |
220 |
aggttgttatattatgggaatctggatggttttaaaaactgataggctgtgattatggctgcaacatttaggtttttgatgtatgcagccgtggccgcaa |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | | ||| |
|
|
| T |
33368355 |
aggttgttatattatgggaatctggatggttttaaaaactgatgggctgtgattatggctgcaacatttaggtttttgatgtatgcagccgcgatcacaa |
33368454 |
T |
|
| Q |
320 |
ttg--------tagtagcatcaaccctaattaaggatcatggctgcgactgaaatttgaaagttgaaaccatggcaatgttgggccccacatttagaggg |
411 |
Q |
| |
|
||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33368455 |
ttgcggtagcatactagcatcaaccctaattaaggatcatggctgcgactgaaatttgaaagttgaaaccatggcaatgttgggccccacatttagaggg |
33368554 |
T |
|
| Q |
412 |
agagtagggccgtgtgagttgtggtcctgtggaggcaacttgggaatgggatagnnnnnnngtatcttcaagtataat |
489 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
33368555 |
agagtagggccgtgtgagttgtggtcctgtggaggcaacttgggagtgggatagtttttttgtatcttcaagtataat |
33368632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 192 - 368
Target Start/End: Original strand, 33360700 - 33360878
Alignment:
| Q |
192 |
atctcaaatcatgtagttgtttcttcttaggttgttatattatgggaatctggatggttttaaaaactgat----aggctgtgattatggctgcaacatt |
287 |
Q |
| |
|
||||| ||| |||||||||||||||||||| |||||||||| || |||| || ||||||||||| | |||| ||||||||||| |||||| || ||| |
|
|
| T |
33360700 |
atctcgaattatgtagttgtttcttcttagattgttatattgtgagaatatgaatggttttaaata-tgatatagaggctgtgattgtggctgtaaaatt |
33360798 |
T |
|
| Q |
288 |
taggtttttgatgtatgcagccgtggccgcaattgtagtagcatcaaccctaattaaggatcatggctgcgactgaaattt |
368 |
Q |
| |
|
|||| || ||||| ||||| | | |||||||| || |||||||| |||||| ||||||||||||||| |||||||||| |
|
|
| T |
33360799 |
tagggattcgatgtttgcagttgcgatcgcaattgcagcagcatcaa-cctaatcaaggatcatggctgcaactgaaattt |
33360878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 36 - 77
Target Start/End: Original strand, 33360606 - 33360647
Alignment:
| Q |
36 |
ttgttgcttcatgtgagctttgttagtactagaatcggttta |
77 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||| ||||| |
|
|
| T |
33360606 |
ttgttgctgcatatgagctttgttagtactagaatctgttta |
33360647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0274 (Bit Score: 55; Significance: 2e-22; HSPs: 2)
Name: scaffold0274
Description:
Target: scaffold0274; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 36 - 122
Target Start/End: Complemental strand, 14607 - 14521
Alignment:
| Q |
36 |
ttgttgcttcatgtgagctttgttagtactagaatcggtttaccaagtgaacgtcctgattgcaacattgctggttttggttatata |
122 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||| |||||| | | |||||||||||||||||||| |||||||||||||| |
|
|
| T |
14607 |
ttgttgcttcatgtgagctttgttagtaccagaataggtctaccaatagtatgtcctgattgcaacattgctagttttggttatata |
14521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0274; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 362
Target Start/End: Complemental strand, 14362 - 14209
Alignment:
| Q |
218 |
ttaggttgttatattatgggaatctggatggttttaaaaactgata--ggctgtgattatggctgcaacatttaggtttttgatgtatgcagccgtggcc |
315 |
Q |
| |
|
||||| |||| ||| || ||||| || |||||||||||||||||| |||||||||| | |||||||||| ||||||||||| |||||||||| | | |
|
|
| T |
14362 |
ttaggctgttgtatgataggaatatgaatggttttaaaaactgatcagggctgtgatttttactgcaacatt-aggtttttgatatatgcagccgcgatc |
14264 |
T |
|
| Q |
316 |
gcaattg--------tagtagcatcaaccctaattaaggatcatggctgcgactg |
362 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14263 |
acaattgcggtagcatactagcatcaaccctaattaaggatcatggctgcaactg |
14209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 55; Significance: 2e-22; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 36 - 122
Target Start/End: Original strand, 41430276 - 41430362
Alignment:
| Q |
36 |
ttgttgcttcatgtgagctttgttagtactagaatcggtttaccaagtgaacgtcctgattgcaacattgctggttttggttatata |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||| | | |||||||| ||||||||||| |||||||||||||| |
|
|
| T |
41430276 |
ttgttgcttcatgtgagctttgttagtactagaataggtctaccaatagtatgtcctgatcgcaacattgctagttttggttatata |
41430362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 264 - 339
Target Start/End: Original strand, 41440245 - 41440320
Alignment:
| Q |
264 |
ggctgtgattatggctgcaacatttaggtttttgatgtatgcagccgtggccgcaattgtagtagcatcaacccta |
339 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||||||||| | |||||||| ||||| |||||||||| |
|
|
| T |
41440245 |
ggctgtgattgtggctgcaacatttaggtttttgatgcatgcagccgcgatcgcaattgcagtagtatcaacccta |
41440320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 218 - 362
Target Start/End: Original strand, 41430521 - 41430674
Alignment:
| Q |
218 |
ttaggttgttatattatgggaatctggatggttttaaaaactgata--ggctgtgattatggctgcaacatttaggtttttgatgtatgcagccgtggcc |
315 |
Q |
| |
|
||||| |||| ||| |||||||| || ||| ||||||||||| || |||||||||| | |||||||||| |||||||||||||||||||||| | | |
|
|
| T |
41430521 |
ttaggctgttgtatgatgggaatatgaatgattttaaaaacttatcagggctgtgatttttactgcaacatt-aggtttttgatgtatgcagccgcgatc |
41430619 |
T |
|
| Q |
316 |
gcaattg--------tagtagcatcaaccctaattaaggatcatggctgcgactg |
362 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41430620 |
acaattgcggtagcatactagcatcaaccctaattaaggatcatggctgcaactg |
41430674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University