View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_high_66 (Length: 306)
Name: NF1435_high_66
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_high_66 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 287
Target Start/End: Original strand, 11212688 - 11212977
Alignment:
| Q |
1 |
caaacatcatttgggtcgcaaaccggaataaacccatcgcatatctcaccggttcagcacttcaattaactcgaaccggtcaattactcttaacccaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||| ||||||||||||||| ||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
11212688 |
caaacatcatttgggtcgcaaaccgtaataaacccatctcatctctcaccggttcagctcttcaattaaccccaaccggtcaattactcttaacccaaaa |
11212787 |
T |
|
| Q |
101 |
cgacaccgttttatggcaaactaaaaacactcttga---atctcctcttcctcaactcaatcttctagaaaatggaaatttagttctggagactaaaaac |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11212788 |
cgacaccgttttatggcaaactaaaaacactcttgatgaatctcctcttcctcaactgaatcttctagaaaatggaaatttagttctcgagactaaaaac |
11212887 |
T |
|
| Q |
198 |
ggtgtcgttttatggcaaacctttgatgaaccaactgacacgtggctaccaggtatgaacttaactagggttcataacttactctcgtgg |
287 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11212888 |
ggtgtcgttttatggcaaagctttgatgaaccaactgacacgtggctaccaggtatgaacttaactagggttcataacttactctcgtgg |
11212977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University