View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_high_75 (Length: 291)
Name: NF1435_high_75
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_high_75 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 11 - 275
Target Start/End: Complemental strand, 3975701 - 3975437
Alignment:
| Q |
11 |
cagagaatgcatacacaagaagacgtagaaatttgctggctttcaatcatggttgggacaagaacaaaaatttccctttgagaagcaatagtggtggcat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3975701 |
cagagaatgcatacacaagaagacgtagaaatttgctggctttcaatcatggttgggacaagaacaaaaatttccctttgagaagcaatagtggtggcat |
3975602 |
T |
|
| Q |
111 |
ttcgaagagaacaatgagcttaagtagaagtgctttagctcttgcagttgcattaagcaattctgatagcagctctagttttacaagtgatgattcagct |
210 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3975601 |
ttcaaagagaacaatgagcttaagtagaagtgctttagctcttgcagttgcattaagcaattctgatagcagctctagttttacaagtgatgattcagct |
3975502 |
T |
|
| Q |
211 |
acttcaacctcatattcttcagcaccttcatcaccacttccgccgcgtcatccgggaaatagagt |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3975501 |
acttcaacctcatattcttcagcaccttcatcaccacttccgccgcgtcatccgggaaatagagt |
3975437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 13 - 122
Target Start/End: Complemental strand, 48514300 - 48514191
Alignment:
| Q |
13 |
gagaatgcatacacaagaagacgtagaaatttgctggctttcaatcatggttgggacaagaacaaaaatttccctttgagaagcaatagtggtggcattt |
112 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||| |||| || ||||||| |||||| ||||| |||||||||| ||| ||||| || | ||||||||||| |
|
|
| T |
48514300 |
gagaatgcttacacaaggagacgtagaaatttgatggccttgaatcatgtttgggagaagaataaaaatttccttttaagaagtaacaatggtggcattt |
48514201 |
T |
|
| Q |
113 |
cgaagagaac |
122 |
Q |
| |
|
| |||||||| |
|
|
| T |
48514200 |
ctaagagaac |
48514191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University