View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_high_81 (Length: 278)
Name: NF1435_high_81
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_high_81 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 52513087 - 52512934
Alignment:
| Q |
1 |
gtttcttctttatccagtaccacatcctatagagttgttggaggaaccaccacccactcttggaccccaaacatcactttgtaagtcacttcttagtttt |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52513087 |
gtttcttctttatccagtaccccatcctatacagttggaggaaccaccaccacccactcttggaccccaaacatcactttgtaagtcacttcttagtttt |
52512988 |
T |
 |
| Q |
101 |
aattatttcctatatatatgcatgaagctaattttttcatttcttctcaatctc |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52512987 |
aattatttcctatatatatgcatgaagctaattttttcatttcttctcaatctc |
52512934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 174 - 262
Target Start/End: Complemental strand, 52512900 - 52512812
Alignment:
| Q |
174 |
atgtggaactctctatcatgtagaattaacgagatgatcatttattgttgtaataattctataaatgttttctgtgtttgagaaatata |
262 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
52512900 |
atgtggaactctctatcctgtagaattaactagatgatcatttattgttgtaataattctataaattttttctgtgtttgtgaaatata |
52512812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University