View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_high_82 (Length: 276)
Name: NF1435_high_82
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_high_82 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 20 - 266
Target Start/End: Original strand, 45704183 - 45704429
Alignment:
| Q |
20 |
tataataggaacttgcagactgataccttcaaccttacaagttttattatttctcatgcgaaaaatttcacattatttcaactctaaagtctcgagttat |
119 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
45704183 |
tataataggaacttgtagactgataccttcaaccttacaagttttattatttctcatgcgaaaaatttcacattatttcagctctaaagtctccggttat |
45704282 |
T |
 |
| Q |
120 |
ttattccttcgatacatgtgataagagcatctattctccatgacccaacttacttcagttttcgaactagttaccactaatgcactcgcattttcataac |
219 |
Q |
| |
|
| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45704283 |
tcattccttggatacatgtgataagagcatctattctccatgacccaacttacttcagttttcgaactagttaccactaatgcactcgcattctcataac |
45704382 |
T |
 |
| Q |
220 |
ccttatactttgactctttgctccctactaaattttttgtctctgtg |
266 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45704383 |
cattatactttgactctttgctccctactaaattttttgtctttgtg |
45704429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University