View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_high_83 (Length: 269)
Name: NF1435_high_83
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_high_83 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 18 - 261
Target Start/End: Original strand, 32560614 - 32560857
Alignment:
| Q |
18 |
agttcaaagggatttggatcagttgagacagtataaaaatggttcttttgatgatatcgaggtgattaagattgatgggaaaaaccctttcttgtggcat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32560614 |
agttcaaagggatttggatcagttgagacagtataaaaatggttcttttgatgatattgaggtgattaagattgatgggaaaaaccctttcttgtggcat |
32560713 |
T |
 |
| Q |
118 |
gatcattggcctgttaaggactatgcaaaggtttttgagtgcttagtcctggttgatgaatttactcaagaagctgatagagttgcctctatgattagaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32560714 |
gatcattggcctgttaaggactatgcaaaggtttttgagtgcttagtcctggttgatgaatttactcaagaagctgatagagttgcctctatgattagaa |
32560813 |
T |
 |
| Q |
218 |
aagttggtagccatgatgataaaggtaattcatttcagaattat |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32560814 |
aagttggtagccatgatgataaaggtaattcatttcagaattat |
32560857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 94 - 161
Target Start/End: Original strand, 10751111 - 10751178
Alignment:
| Q |
94 |
gggaaaaaccctttcttgtggcatgatcattggcctgttaaggactatgcaaaggtttttgagtgctt |
161 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| | || |||||| |||||||||||||||||| |
|
|
| T |
10751111 |
gggaaaaaccctttcttatggcatgatcattggcctttgaaaaactatggaaaggtttttgagtgctt |
10751178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University