View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_high_93 (Length: 255)
Name: NF1435_high_93
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_high_93 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 118 - 233
Target Start/End: Original strand, 50831010 - 50831125
Alignment:
| Q |
118 |
aagcactcccctccgtctttgacttggctacatagccttcgacacttagaacggtactactgaaatattaagaacactgtaattcaaggtaatgtcatgc |
217 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||| ||||||||| |||| ||||| | ||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
50831010 |
aagcactccccttggtctttgacttggcgacatagccatcgacactttgaaccgtacttccgaaatattaaggacactgtaattgaaggtaatgtcatgc |
50831109 |
T |
 |
| Q |
218 |
agtttctaaaagccca |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
50831110 |
agtttctaaaagccca |
50831125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University