View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_low_102 (Length: 253)
Name: NF1435_low_102
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_low_102 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 8946960 - 8947170
Alignment:
| Q |
1 |
tagatactgttcaggtttagaaaacgaagctgcaatagtcttcaactccaaactagtatctcaaatggatgcctttgaaaataaatttctagaggctaag |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8946960 |
tagacactgttcaggtttagaaaacgaagctgcaatagtcttcaactccaaactagtatctcaaatggatgcctttgaaaataaatttccagaggctaag |
8947059 |
T |
 |
| Q |
101 |
cttgtctaccttgatatttacaacccattcatgcatatgattcaaaaccctgataaatatggtaacaatcagacacaagcattgtcattttcacctttta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8947060 |
cttgtctaccttgatatttacaacccattcatgcatatgattcaaaaccctgataaatatggtaacaatcagagacaagcattgtcattttcacctttta |
8947159 |
T |
 |
| Q |
201 |
tacgtagctta |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
8947160 |
tacgtagctta |
8947170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 8 - 122
Target Start/End: Original strand, 8939434 - 8939548
Alignment:
| Q |
8 |
tgttcaggtttagaaaacgaagctgcaatagtcttcaactccaaactagtatctcaaatggatgcctttgaaaataaatttctagaggctaagcttgtct |
107 |
Q |
| |
|
||||||| ||| |||||| |||| |||| | |||||||||||||| |||||||| ||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
8939434 |
tgttcagattttgaaaaccaagcagcaagactcttcaactccaaattagtatctaaaatggatgcctttgaaaataaatttccagaagctaagcttgtct |
8939533 |
T |
 |
| Q |
108 |
accttgatatttaca |
122 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
8939534 |
accttgatatttaca |
8939548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University