View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_low_107 (Length: 250)
Name: NF1435_low_107
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_low_107 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 49 - 250
Target Start/End: Complemental strand, 31613590 - 31613389
Alignment:
| Q |
49 |
caaaattgaaatctaaacaaataaaccaaaccagcagcagtaagtaaagaaaggagacattagtttgcaagcatgttcatacactagatgttgcagaagt |
148 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31613590 |
caaaattgaaatctaaacaattaaaccaaaccagcagcagtaagtaaagaaaggagacattagtttgcaagcatgttcatacactagatgttgcagaagt |
31613491 |
T |
 |
| Q |
149 |
gaccttttgccctgcctccattccagttaatgtatcatagagtggttggtttagtgtctctggcaagaaaaacgcaaaaaccccagcagcaattccacaa |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31613490 |
gaccttttgccctgcctccattccagttaatgtatcatagagtggttggtttagtgtctctggcaagaaaaacgcaaaaaccccagcagcaattccacaa |
31613391 |
T |
 |
| Q |
249 |
aa |
250 |
Q |
| |
|
|| |
|
|
| T |
31613390 |
aa |
31613389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University