View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_low_116 (Length: 242)
Name: NF1435_low_116
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_low_116 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 9 - 225
Target Start/End: Original strand, 26944985 - 26945201
Alignment:
| Q |
9 |
ttatatgaagatcctttccattatcagaatatttttatttttgaagtgaaatttatcttcttttatatatagcttggagtacctctagtactctatttta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26944985 |
ttatatgaagatcctttccattatcagaatatttttatttttgaagtgaaatttctcttcttttatatatagcttggagtacctctagtactctatttta |
26945084 |
T |
 |
| Q |
109 |
tattaaaaagaattggttacttcaaaaagaaatgattgccacatcttttgcatatttagataaatgtattcatatctaattataattctattttgttttt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26945085 |
tattaaaaagaattggttacttcaaaaagaaatgattgccacatcttttgcatatttagataaatgtattcatatctaattataattctattttgttttt |
26945184 |
T |
 |
| Q |
209 |
ggtaggtgagtgtgaaa |
225 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
26945185 |
ggtaggtgagtgtgaaa |
26945201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University