View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_low_118 (Length: 240)
Name: NF1435_low_118
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_low_118 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 39 - 221
Target Start/End: Original strand, 31425360 - 31425542
Alignment:
| Q |
39 |
tttattgcacgttaatgtcgcattctttcatagttaatgatgttgataccatatcgtctgatacttaatcaacaataatttgtggttgggttttggttcc |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31425360 |
tttattgcacgttaatgtcgcattctttcatagttaatgatgttgataccatatcgtctgatacttaatcaacaataatttgtggttgggttttggttcc |
31425459 |
T |
 |
| Q |
139 |
aatttatttatttttgtgacaaactaacaatttagttttttctcatgaagtacgtaatattattttcgtggttttctaaagta |
221 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31425460 |
aatttatttatttttgcgacaaactaacaatttagttttttctcatgaagtacctaatattattttcgtggttttctaaagta |
31425542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University